domingo, 22 de junho de 2014

[Programação em C] - Algoritmo Motif (Finding a Motif in DNA)

Olá pessoal, nesse post iremos colocar uma implementação simples do algoritmo de Motif utilizando a linguagem de programação C.

Trata-se de bioinformática, motif é um padrão de nucleotídeos ou aminoácidos que ocorrem entre diversas espécies. Encontrar um motif é buscar todas as ocorrências de um padrão de nucleotídeos em um genoma.

O programa pede que o usuário entre com DNA e um padrão.

Exemplo de entrada de DNA: 

GATACGGATAATAGTATAGATAGATAGACGTAATAATCGATGTAGATAAGTAGATAGACGATACATGATAGAC

Exemplo de entrada do padrão: GATA

A saída para essas entradas deve ser: 0 6 18 22 44 52 59 66

A imagem acima foi retirada da apresentação "Bioinformática com Rosalind" do Marcos Castro, você pode conferir esse problema a partir do slide 26, é um problema do site Rosalind, só que na apresentação a solução está em Python, segue o link da aparesentação:


Nesse post iremos implementar em C, veja o código:





Nenhum comentário: