domingo, 21 de dezembro de 2014

[Programação em C] - Verificar todas as ocorrências de uma subcadeia em uma cadeia de DNA

Olá pessoal, nesse post iremos ver um código (todo comentado) que resolve um problema de Bioinformática: verifica todas as ocorrências de uma subcadeia em uma outra cadeia de DNA.

Exemplo de cadeia: TCATATGCAAATAGCTGCATACCGA
Exemplo de subcadeia: CATA
Ocorrências da subcadeia na cadeia: 2 e 18

Veja o código todo comentado:



Fácil não é mesmo?



Nenhum comentário: