Últimos Posts

domingo, 21 de dezembro de 2014

[Programação em C] - Verificar todas as ocorrências de uma subcadeia em uma cadeia de DNA

Olá pessoal, nesse post iremos ver um código (todo comentado) que resolve um problema de Bioinformática: verifica todas as ocorrências de uma subcadeia em uma outra cadeia de DNA.

Exemplo de cadeia: TCATATGCAAATAGCTGCATACCGA
Exemplo de subcadeia: CATA
Ocorrências da subcadeia na cadeia: 2 e 18



[Haskell] - Jogo da Velha

Olá pessoal, nesse post irei colocar as vídeo-aulas que explicam a implementação de um joguinho da velha feito em Haskell.

Esse jogo da velha foi desenvolvido no curso "Haskell para iniciantes" feito com apoio do GeeksBR. Para acessar todas as aulas clique aqui.

Caso você seja iniciante em Haskell, é bom ver as aulas anteriores, pois a implementação desse jogo faz uso de recursos do Haskell que foram explicados em outras aulas.



sábado, 20 de dezembro de 2014

[Programação em C] - Lista encadeada (linked list)

Olá pessoal, nesse post irei colocar a implementação de uma lista encadeada simples com várias funções tais como: criar lista, adicionar na lista, remover da lista, listar os elementos, verificar o tamanho da lista, buscar elemento na lista, verificar se ela está vazia.

O código é um pouco grande, mas está todo comentado, veja:



sexta-feira, 19 de dezembro de 2014

[Haskell] - Reter casas decimais

Olá pessoal, nesse post veremos como reter casas decimais em Haskell.

É muito simples, basta utilizar a função printf da biblioteca Text.Printf, veja:


"%.2f" significa que irá ter 2 números após o ponto. O "f" vem de float, pois é o especificador de formato para esse tipo.



domingo, 14 de dezembro de 2014

[Linux] - Tutorial Hardening Linux, SSH, DHCP, DNS e Apache

Olá pessoal, esse post é para divulgar um tutorial que fizemos que contempla os seguintes assuntos:

Hardening Linux: técnicas de blindagem do sistema.
SSH: configuração do serviço SSH.
DHCP: configuração do servidor DHCP.
DNS: configuração do servidor DNS.
Apache: configuração do servidor Apache.

Tudo isso em um só tutorial de 28 páginas, simples, mas bem explicado.

Clique aqui para fazer o download do tutorial

Quaisquer dúvidas, correções ou dicas, deixem nos comentários.